CX287105

Overview
NameCX287105
Unique NameCX287105
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length487
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig13444 contig Ccv1_Contig13444:21..507. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01004G05SK Veg1 Citrus clementina cDNA clone C01004G05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287105 ID=CX287105|Name=CX287105|organism=Citrus clementina|type=EST|length=487bp
AAGTTCACTCTCGATAATTCATTTCGTTTCGGCAGCCGAAGAGAGACTGT
CACTATCTTCCACTCTGAATCTATCGACACGATACTAAAAAAGTTGACTA
AAGATTGGCTGGCGCAGTTTGCACGCGGAGAGCAGGTCCAGGCCGATCTG
ATTGGGTGGAAGAAGATGTTGGTGAAGATAAATGAGGTCCTAGGTGATGC
GGTGGAGAAACAGATGAAGGAGGAGTCAGTGAAGAAGTGGCTCGGCAAAC
TTCGCGACTTGGCTTGCGATGTTGATTACTTGTTGGATGAGTTTCAAACG
GAAGCTTTCCAGAGGACGTTACCGCAAGAAGATGTTGATGATGCCGTGGA
TAAGTCCGATGATGCTATGGCCATGTCTAAAGTAAAGGAGGTCAACGCTA
GATTGCAAGATATTGCATCGCAGATAGAACTACTAGGTTTGGGGAAAAAA
TCAGGCGGAAAGTCTAGAAATGTCCGCAGAGCAAAAA
back to top