CX287109

Overview
NameCX287109
Unique NameCX287109
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length642
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC01004G09SK Veg1 Citrus clementina cDNA clone C01004G09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287109 ID=CX287109|Name=CX287109|organism=Citrus clementina|type=EST|length=642bp
GCACGAGGCTCCATTCTTCTCTCAAAATCCTAACTGAATGATTGTTCAAA
TTCTTACAACAGCAAAAACAAAAACAAAACTCAACTGCTGCTTCTGTTTC
TGACTTTCTGTTTCTAATGGTTGTTATTTCGCGAGCCTCAAAACTCAGTC
TCCCTAATCCTTCTCTTCCTTCATCACCACCCCAAATAACCTCGGCCTTA
TACGAACCAAATTCTCTTTCTTTAGCCCTTATGCGTTCTGATTCTTCTAT
CTCTCTTTATTCTTCAATTTCCCTTTTTACCCTTTCATCTCTCCCTTCAA
CCCCTCAAGTTTTAATCCCTTCACCTTCATATTCATTTACCTTTTTGCTC
TTAAATCATACCCCTAACCCTAACCCTAGCCCTAGGGTGGCTTTTATTGC
TGTGGGTCCTCATAGAAGTGAGCCTAAGCTTGTTTTAAGATTGTATGTTT
TGAAAAGAAACAATTTTTATGGGAAAGCTCAGGTCTTTTGTAAGCAAAAG
GGTGTTTCTTTTGACGAGAAGTTGGGGGTTTTGTTGGATATTACTCATGG
GGTTGGATTGAAGCTTGTTGGGTCGGTTAATTTCTTTGCAATGCACTCGT
TATCAAGCTCTAAAATTTGGGTTTTTGGTGTGATGTTGATGG
back to top