CX288528

Overview
NameCX288528
Unique NameCX288528
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length561
Libraries
Library NameType
IF1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC02001D11SK IF1 Citrus clementina cDNA clone C02001D11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX288528 ID=CX288528|Name=CX288528|organism=Citrus clementina|type=EST|length=561bp
GAAATGGAGGCTAAGAAAAAGAAATTGCAGATGATGAAACAGAAAAAATT
GACCTTACAGAGTGAAGTCCGGTTCTTGAGAAGACGGCACCAATACTTGA
CAGCCAACCAGCCCTTGACTTCGACAATGGGCCAAAATTCTGTAAAGGCT
CAGCAGAAACCAATCCCAAGTAGGAAAATGGCAAAAGAAAGGAATTACGG
CAGAAAGGCAGCTGCTTTGTGTCGCCCACCTTTAGGTTTTGATCTAAATA
AAAAGGGAAAGGCTTATAATGAAAAGGAAGCAACTTTGCGAAACCCAATT
GCTGTTTTTGATTTGAACCAGAAGCTGAAGGCTTACAATGGAAAGGAATC
AACTTCGCTACATTCCTTGCCAGTTCTTGATCTAAACCAGAAGGAAAGGG
TTTACAGTCGAAAGGATGCTGCCATACAAAACGTGACTCCAGTTTTTGAC
TTAAACCAGATATCGAGAGAGGAGGAAGAATTCAATAGCGAGCCATGGAG
GGTAGAGGAATCAAATAAAAGTTCAGTCAGAGGTGGAAGTGAGGAGCAGC
TTAATGACATG
back to top