CX288682

Overview
NameCX288682
Unique NameCX288682
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length456
Libraries
Library NameType
IF1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CX288682_ssr180 microsatellite CX288682_ssr180:180..206. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC02003B11SK IF1 Citrus clementina cDNA clone C02003B11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX288682 ID=CX288682; Name=CX288682; organism=Citrus clementina; type=EST; length=456bp
CATGAATGATAACGTTATAAAAAATTCTTCACCATCTTCTTCTGTTCGAC
GAATCCATGCAGAAAAGAACAAGGCGAATGGCACGTCCGATCTTTGTTTT
GCATGGCTCAATCTTGGAGTCCAGAGAGATGCACGTGAAAGACGAGAATA
GTAATGAAGACTTATTACATAAAGATCAAGGTGGTGGTGGTGGTGGTGGT
GGTGGTGGACGTGAGAGGCTGAAGAGGCACCGAGAAGAGGTGGCGGGTCG
GGTTTTGATACCGGATACATGGGGTCAAGAGGGTCTGCTTAAGAATTGGA
TTGATTGTTCAGCTTTTGAGGCTTTAATGGTTCCTAATAAAATTGCTTCT
GCTCGCAAAGCACTTGTTGCTGATAATAGGGGTAGCCCTAGAGCCAGTAA
CACTACTACTTCTCTTCAGCAACTGAGGATAGAAAGTAGGTGTTAATTAT
TTAATT
back to top