CX288950

Overview
NameCX288950
Unique NameCX288950
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length397
Libraries
Library NameType
IF1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9591 contig Ccv1_Contig9591:7..403. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC02007C07SK IF1 Citrus clementina cDNA clone C02007C07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX288950 ID=CX288950|Name=CX288950|organism=Citrus clementina|type=EST|length=397bp
TTCCGCACGAGGCTACTTACCTTTTGAGTTTTGAATACGGTTCAGCCCAA
GCCAGCAGAAATCGCTTGCCTTCCTGATTCGAAGATTATGGGAACTCCTT
GCGCAGGTTATACCGATTGGTCGGAGGGGCTTATAGCCACAACTTTTTCA
CTTATTGCTGATGATGAAATTAATGGAAATATTGATCTTCTTGCGGTCCC
GCAATATGGAACAAACCCTAATCACACTGGTTAAGAATATGCAGTATTAG
TCTCTTATGTTATGTTTAAGAAAATAAAAGTCTGGGTACTGTTATTACCC
GTCAATTGTATGATGGTCTCAATTTGGTTCAATTTAACTTGTAAGATCTC
TTGATATATATAAGAGATTCTCTTTGTCTAAAAAAAAAAAAAAAAAA
back to top