CX288955

Overview
NameCX288955
Unique NameCX288955
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length602
Libraries
Library NameType
IF1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CX288955_ssr124 microsatellite CX288955_ssr124:124..138. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig167 contig Ccv1_Contig167:18..619. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC02007C12SK IF1 Citrus clementina cDNA clone C02007C12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX288955 ID=CX288955|Name=CX288955|organism=Citrus clementina|type=EST|length=602bp
GGCTAACGATGAAATTTTGGAAGAGCTTAAGCATATTGATCGAAGAGACG
TTACCTGAATGGAGAGACAAGTTCTTGTCCTACAAGGATTTGAAGAAGCA
GTTGAAATTGATCTACCCCGAGAAGCAGCAGCAGCAGCTTAATTGCGACG
GTGGTATCAATAAACGCCTTAGAATCGAGGGCCCGGAGGAAACGGACGGC
GGGGATTGCGCCAGTAGTAAGGAGGATAATGAGGAGGCGAAGCAGGTGAA
TGATTTTGTGAAGCTGTTGGAGGATGAGATTGATAAGTTTAATGCGTTTT
TTCTTGAAAAAGAAGAGGAATATGTTATCAAATGGAAGGAGTTGCAAGAT
AGGGTAGCAAAGTCCAAGGATTCAAATGAAGAGTTGATGAAAGTAGGGAG
GGAGATAGTTGATTTTCATGGGGAGATGGTTTTATTAGAGAATTACAGCG
CTCTTAACTACACAGGACTAGTGAAGATATTAAAGAAATATGACAAGCGA
ACTGGTGCTCTTATTCGCTTGCCCTTCATCAAAAAGGTATTGCAACAACC
ATTCTATACTACTGATGTGCTCAACAAGCTTGTGAAGGAGTGCGAGGTAA
GG
back to top