CX290872

Overview
NameCX290872
Unique NameCX290872
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length478
Libraries
Library NameType
OF1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig328 contig Ccv1_Contig328:1..478. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC03001B06Rv OF1 Citrus clementina cDNA clone C03001B06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX290872 ID=CX290872|Name=CX290872|organism=Citrus clementina|type=EST|length=478bp
TCTTGGCACGACAGCTCTCAGTCTGGTGACCACACCATTGCTTTTCAAGC
TGATCCCTGCCGTTGTAAATCTTGGGGTACTGTTGCGGTGGTTCTCCCCC
GATTCTCCAATCGAGATTGGATATAAGGGAGATAGTCTTCGTGCAGACAG
TGCTAAGCGCATAACTGTGATGGTCCAAGGCTCACATCATGATTCATGAT
ATTAAATAAAACACGAACCAGAAAAAAAATGCAAAATATTTCAGCCTTAT
CCTGATGGGCTTCTTATGCTCTGGGGGACAGGTGCTTAAAAGTGCCAAGG
AGGTTTGACTGAATGTACAAATTTTGTGTGTTTAAAAGCTCTTCATTTGT
TGCCCAATTCCCACTTGGCTTTCTATTTCTGACCAAGCTCGAGTGAGAGA
GACCATGATGCCCAGCCGGGACCAAGATGTTAATGACCCACGTCTGAGTA
TATACTTACTAATTTCCCATTCAGGTCA
back to top