CX293878

Overview
NameCX293878
Unique NameCX293878
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length594
Libraries
Library NameType
FlavRip1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC05002A03SK FlavRip1 Citrus clementina cDNA clone C05002A03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293878 ID=CX293878|Name=CX293878|organism=Citrus clementina|type=EST|length=594bp
CTCGTGCCGAATTCGGCACGAGGAGATTTCTGGCCACGATATTGGGGTGG
TGTTGTAGTCTATGACCAGGGTATGGAATTCTTTAAAGCTCTCGGGGGTG
GAAAGTTGCTCAAGGACAAGTTCCTATCAGGATTTCTTCTAAACCCCCGA
GCTATTGCAAACTATAAGCGTGCAAGAACCCTGGGAGTAGAGCAAAACTT
TAAAGGTGAAGGTGAAATTAAGGGCGGGCTCTTTATCGTTGGCAGAGGAC
GAAGTGGTATAGCTTACCAGTTTATCGAGAGGAATTTTGGTGATTGGGCA
CCTCTAGCTGAAGCAATTGAGATCTGTACCCAACTGCAGGACCAACAGCA
AGATCAATCAGAGACAATCAAAACATCACAAGAATAGTATTTAAGTTTGC
TACAATTTTCACGTCTTCTTCAGATTTACATCTAGTAAATTTCTATTTTC
TTTTATTACAGGAGAGAGATCTAGTCTAATTTCATCATTCTTTTCTTAAG
GCTTGCCACTTGTATTTCCTTGTGTGGGTTGTATGGATAATAATTTTTTA
ATTCAAATACTGCAATTTATTCTAAAAAAAAAAAAAAAAAAAAA
back to top