CX293895

Overview
NameCX293895
Unique NameCX293895
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length353
Libraries
Library NameType
FlavRip1cdna_library
Properties
Property NameValue
Genbank descriptionC05002C02SK FlavRip1 Citrus clementina cDNA clone C05002C02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293895 ID=CX293895|Name=CX293895|organism=Citrus clementina|type=EST|length=353bp
TTATTGGCATATCACAGTGTGTCTCATGTTCAGATCATGGGACGATCATT
ATCACCTGCATTCGGTATTGAAAGCCCTGAACCCTCTGGGAGATTTGCAT
TGAAGGTTCTGAGTTATGCTCAACCCACACTTGATGATCCATCCTTAATC
CAGAGTGCGTATTTACGGAGGCGTGTGGGGCAGATTATAAACATCTTGCG
GGGCAATGCTGTAGATGTTGTGGAATATGAGTGGGGTGAAGAAGATGATG
AATCAGATGATGAGTTCGTTCTCTAGTGTGTCACATAAATCTAAATTGTA
TCTCCTTTTTCACTTTGATCCCTGCTTTTGCACCAAGTAATAATTCCATT
TGG
back to top