CX293978

Overview
NameCX293978
Unique NameCX293978
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length584
Libraries
Library NameType
FlavRip1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05004D02SK FlavRip1 Citrus clementina cDNA clone C05004D02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293978 ID=CX293978|Name=CX293978|organism=Citrus clementina|type=EST|length=584bp
GATCATCCGTCGCATGACGTGGCGGCAGGGCAGAGGTTCGTGAAGGAGGT
GTACGAGACCCTAAGGAGTAGCCCGCAGTGGAACGAAATGGCTTTCCTGA
TTACGTACGATGAGCATGGCGGCTTTTTTGATCACGTGCCGACCCCCGTT
TCTCACGTGCCCAGCCCCGATGGGGTTATTGGGCCTGACCCGTTTTTCTT
TCGGTTTGACCGATTGGGCGTTCGGGTCCCGACTTTGTTGATTTCGCCGT
GGATCGACAAGGGCACTGTGATCCATGGATCAAATGGACCAACTCCACAT
TCAGAATTTGAACATTCATCTATACCTGCAACTGTGAAGAAGCTTTTCAA
CCTAAAATCCAACTTTTTGACAAAGAGGGATGCATGGGCTGGCACTTTTG
AGAAGTTCCTTCAACTCCGTAAAACTCCACGTGATGACTGTCCAGTTACT
CTACCTGAGGTGACAAGGTCTCTTAGACCATGGGGACCTAGGGAAGACAA
GGAACTCTCAGAGTTCCAGTTGAACTGATCCGCTTGCAACCAGCTAGTGG
GTGATATGTCCTGAATACTACCCGGATTGGGCAA
back to top