CX293996

Overview
NameCX293996
Unique NameCX293996
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length457
Libraries
Library NameType
FlavRip1cdna_library
Properties
Property NameValue
Genbank descriptionC05004E12SK FlavRip1 Citrus clementina cDNA clone C05004E12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293996 ID=CX293996|Name=CX293996|organism=Citrus clementina|type=EST|length=457bp
CTCGTGCCGAATTCGGCACGAGGGTTTGTGTTTCTATGTAGAGGGTCTGA
GTTTAAATAAAATTGTTTCCAAACATTATCCAGAGCCTTACCTGCTCATG
CAGGGTTGTGCTTAGATTTTCCCTTGTACTATGCAAGAACAGTTGGTGAA
CCAACTTATATTTTGTTAGCGAGAAAACAGTTGTCTATTGGAAACTTGCG
TTTATGAAACAAAAAGAAAAAAAATGACCCGGATAAAATAATGTAGATAG
ATATATTCATTTTAAACCTTCTCTTATCTAATAAAACGTGGTGGGGTTAT
GTAATGGTAGGGCTTGAGCAGCCTTTACCTTTCCGATTTGCTGCATTTTT
CCTGTTATTGTGACCAAGGTCTTATGTTTTTGGATTTCCAGAGATGTAGA
TGTTAAACCAATATCTTCTTTTATAATAAGAGTCATATTATTATAGGGGG
GGGAAAA
back to top