CX294000

Overview
NameCX294000
Unique NameCX294000
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length307
Libraries
Library NameType
FlavRip1cdna_library
Properties
Property NameValue
Genbank descriptionC05004F05SK FlavRip1 Citrus clementina cDNA clone C05004F05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294000 ID=CX294000|Name=CX294000|organism=Citrus clementina|type=EST|length=307bp
AAACATTAATTTCATTTGATCCTATTATGAGTTCTGGAACAAGTTTTACT
CTAAATTGGGTGCCGCATGTGTATGGTTCAAATTAGATACATCAATCAGG
TCGCGATGTAACATGTAACACTAATTGTCATTTAACCTTTCAAGTTTTTT
TTTTTTTTGTTTTGGAAAAAAATTAACCCTTTCGGGTTAAAACCCCTTTA
ATGGGCCCATAAATTAAAAACTCCTTACAACACCCCCGGGGGTTTGCTCA
GCGGCTTTTTTTCCGGGCCCCGGACCCCCGGGGGGTTCCCCCCCGGCCTT
TAAACTT
back to top