CX294334

Overview
NameCX294334
Unique NameCX294334
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length457
Libraries
Library NameType
FlavSen1cdna_library
Properties
Property NameValue
Genbank descriptionC05015D01SK FlavSen1 Citrus clementina cDNA clone C05015D01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294334 ID=CX294334; Name=CX294334; organism=Citrus clementina; type=EST; length=457bp
ATAATTTGCGCTCTGTTAGAGTCTTCGTCTACTCTTTGCATTCACAGCTA
TGCATTCAGAGAATAGCTCATGGCGTTCACAGACTCAGTTGTTCACAAGC
TCTTATTGATGTCTTTGGAGTATACATACATGAACTGCATCAAATTCTGC
ACTAGTAGTTGCACATGTTACATAGGTACTACTAGGGTTTGGATCAGTTC
CTGGCTGGTCTGTCGAGATTTGTCTCATTGCCAAAAAATAGTTGCTGAAC
GCTTCAAGAATTAAGGATTTTATAGATCCTGGGACTGGTACACAAATTCA
GATCAGGTTAGTGCAATCCTGTAAACTTATAACTAAAACTGAATTGATTC
TTGATGTGTTCTTGTTCATAGCTTTATTTCTCTTTGGAAAAAAAAAATGG
TTTCACTAGAACTACTTCATTGTAAAGGGTGAACTACTGCGGCTGAATGA
ACAAAAT
back to top