CX294339

Overview
NameCX294339
Unique NameCX294339
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length585
Libraries
Library NameType
FlavSen1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05015D06SK FlavSen1 Citrus clementina cDNA clone C05015D06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294339 ID=CX294339; Name=CX294339; organism=Citrus clementina; type=EST; length=585bp
ACAGGCATCATTCATCGTTCATTTTTATTTCATTTTTTTCTCTCTGTATA
TAAATTCTTCTTCCTCCCACAAACAACTCACAGCAAATCCAAGATGGGTT
TCTTCTCAAAGGAAGAAAAATCAAAAATTATTTTGAGAGCCTTTAAAACT
TTGTTTTTCTTGATCACCATGTTAGTTTCTCTGCTTCTCTTTTCAGCCCC
GGTTTTGCTAGCGATTGCTGACACCCTTCTCCCTTCTGCTCTCCTCTCCG
CTTCCCTTTCTCCTTCCTCTTTGTCCCTCAGCACCCTCTCTTCCCATTTC
AATGACTACGACTTTCGTTACTCTCTCGTCGACATCCCACTCATCTCCAT
CATCCGATCAGCTGTCATCATCTGTGTTTATGGGTTGTGCGATGGGCCAA
GGCGCTCAAGGGGTCCATATTTGGGAATCACAACCATCTGTTCAGTGCTA
TCTTTGATTTTCGTTTCATTAAAGGCTTCATATGTTTTCAGTGTTGCCGA
TATTGATAGAGGAGTCTACGTTAGAGCCATGGAAATGGCGTTGTTCATCT
GCTCGTTGGCTTTGCCGTTGGTATATCGTTGTTGC
back to top