CX294782

Overview
NameCX294782
Unique NameCX294782
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length663
Libraries
Library NameType
FlavSen1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig2692 contig Ccv1_Contig2692:460..1123. BLAST: Citrus Unigene V1 Contigs to TAIR9
Properties
Property NameValue
Genbank descriptionC05055H04SK FlavSen1 Citrus clementina cDNA clone C05055H04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294782 ID=CX294782|Name=CX294782|organism=Citrus clementina|type=EST|length=663bp
GAATGATGATTAATTAAATCCCATGTTAAGTGAATCAAAATGAAAGATTC
ACAGGCACGGGGTAGGAAATTATGTTTGATGTTTACTTTTGATTTTCTGT
ATTTCTGCTCACCAAGTTCTGCTTTTTCTAATCTTCAATGTGCTTAGAAG
TTGCGAAATTTCATCTTTTTATGTGGTCACTTACCTTGGCTTGGTTTCTT
TATGGTCAATGCATATATAGTAATTTATCAGAGTAGTTTGAATGTTTGTT
ATTTTGATGCTTGTATCAAATGTCTATATCTGAGGTGATGCTAATAGTTT
TTTCTGCCTCTTTTGTAAATTGGCTCTTTGAAATTGGAGCTGGGGTCTGT
GACATGGTGACTGGGTACTATTGACTTTTCCTGGATTTTGTTTCTGGGTT
GGGTTCGTCCTGGCAATGGGAGCCATATATAGAAGGAGAAAGATGAGGGA
AGTAGTGGCCCTGTACAGCTTTCGAAGTTCTTAAGGCGAGACAAAGGTGA
TGGAGTCCGTCGAAGTGCTGTTTCTGGCAAAAAGATTCTATTGAAACTTG
ACACATCGAAGGAAGATAAAGAAGCAGATAGCAAAAGAAATGAATTGCTG
AAATTCTTAAATGCTAATTTTGACTGAGATTGGAGGCCAGTGTCAAAGTC
TAGAATCAAGAAT
back to top