CX294804

Overview
NameCX294804
Unique NameCX294804
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length573
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig578 contig Ccv1_Contig578:1..573. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PhIFruit1cdna_library
Properties
Property NameValue
Genbank descriptionC05056B07SK PhIFruit1 Citrus clementina cDNA clone C05056B07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294804 ID=CX294804|Name=CX294804|organism=Citrus clementina|type=EST|length=573bp
CTCGTGCCGAATTCGGCACGAGGAATTTACCCAGTAATGTTGTTGTAATT
GGCTCCCATACTCAGTTGGATAGTCGCAAGGAGAAGTCTCATCCTGGTGG
CCTTTTATTTACGAAGTTTGGCAGCAATCAAGCAGCTTTACTTGATCTAG
CTTTTCCGGATAATTTCAGTAGACTGCATGATAGAAGCAAAGAAACACCC
AAAGCATTGAAGCAAATTTCTAGACTTTTCCCTAACAAAGTGACGATTCA
ACTGCCTCAGGATGAAGCTTTACTTTCGGACTGGAAGCAGCAGTTGGAGC
GTGATGTTGAAACACTGAAAGGGCAGTCAAACATCATCAGCATACGTTCG
GTCCTTAGCCGAAATGGTTTGGATTGCGTTGATCTTGAAAGTCTATGCAT
TAAAGATCAAACTCTTACAACCGAAGGTGTGGAGAAAATAGTGGGCTGGG
CTTTAAGTCACCACTTTATGCATTGTTCAGAAGCTCCAGGAAAAGATGCT
AAACTTAAGATATCAACTGANAGCATTATGTATGGGTTGAACATTCTACA
GGGCATTCAAAGTGAAAGCAAAA
back to top