CX294810

Overview
NameCX294810
Unique NameCX294810
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length637
Libraries
Library NameType
PhIFruit1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig5444 contig Ccv1_Contig5444:369..1005. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05056C03SK PhIFruit1 Citrus clementina cDNA clone C05056C03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294810 ID=CX294810|Name=CX294810|organism=Citrus clementina|type=EST|length=637bp
CTCGTGCCGAATTCGGCACGAGGCTTTCACTTCAGTATACTAAGTACTTT
CCTAATAATGTTATCAATAGCATCACTTTAAAGGAAGCTATTGTGGCTAT
ATGTGATGATCTTGGGGTTCCTATACCGGAGAAAATCCGGTTCTTCAGAT
CACAGATGCAAACGATAATAACAAAGGCATGTAAAGAGCTAGATATAAAG
CCAATCCCGAGTAAACGGTGTCTATCACTACTTCTCTGGTTGGAGGAACG
CTATGAGACTGTGTATACTCGTCATCCTGGTTTTCAGAAAGGATCTAAGC
CGCTTCTGGCATTAGATAATCCTTTCCCAATGGAACTTCCAGACAACTTA
TTTGGAGACAAATGGGCATTTGTCCAGTTGCCCTTTTCAGCTGTTCAGGA
AGAGGTGTCATCCTTAGAGAGCAAATGTGTATTTGGTGCAAGTCTTGATT
TGGATTTATTGGGAGTTGAAGTCGATGACAAAACTTTGATTCCAGGACTT
GCTGTTGCTTCTTCTCGTGCAAAACCATTAGCAGCTTGGATGAATGGGCT
GGAAGTCTGCTCAATCGAAACGGACACTGCTCGAGGTTCCTTGATTCTAT
CTGTTGGGATATCCACACGCTATATTTATGCTAATTA
back to top