CX294812

Overview
NameCX294812
Unique NameCX294812
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length617
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Libraries
Library NameType
PhIFruit1cdna_library
Properties
Property NameValue
Genbank descriptionC05056C05SK PhIFruit1 Citrus clementina cDNA clone C05056C05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294812 ID=CX294812|Name=CX294812|organism=Citrus clementina|type=EST|length=617bp
TTTTTTTTTTTTTTTTTACCAGATCAACTGTTGTTTCTTCAGAACTTGTT
AGGAAAGGTTACTAGCAGTAAAGTTAGATGAATATACATACTGCTATGAA
ATTTGAACAGCTCCTTACATAATTGGTGTAACTTCTTATACAAACAAGTT
CCCTTCCCGGCAATAGATATCAATATTCAGATACTCAAGAAATTATAAGG
GTGTTGAATGTGTTGTTTTTGGCCCTTACTAGTTGCTCGCGTCCAAGTCA
AGCGAAAAGTATGCACCCAAGTACTTACTGTTTTTATAATAAAACTCAGA
AACTTCACTTCCTCCCAACGTAAGCTCCCAGTTTAGACAGATCAGGATTC
CAAAATGATAGCTCAGATGATCCGATACAAACATGAGACTTCCAGGGGCC
CATGTTATGACAGGAGGCTCTGTATGAAAACTCATCCAACTTGCAACCCA
TTGTTGGTTTGCCCAGAAGACTGTGAATACTATGACTGGGTCAGTGTAGG
GGAAATAACATCCCTTTGAATTCTAAGCATTCAAAAGGCACGAGAATCAA
GGAATTTTGCTTATCAAACCTCTTTCCTGCTCCTTGCACTCCAGCATATA
CACTACCATCACCAGAA
back to top