CX295007

Overview
NameCX295007
Unique NameCX295007
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length568
Libraries
Library NameType
DroRLeaf1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05065E12SK DroRLeaf1 Citrus clementina cDNA clone C05065E12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295007 ID=CX295007; Name=CX295007; organism=Citrus clementina; type=EST; length=568bp
TAATGCCTGAATATACAAGAAAAATATCGTTGTTTTTGGAATTTTATTTA
AAGATATTTTCCTTCACCCAGAATGTAGGGTGATTAATTAATTCATGTGG
CTGTTCTTATCTTTCAACTTTGCTTCCTTCTTGAAAAAAATCCTCCATTC
AGATACTTCAAACAAACCAACACAGCTTCAACTTTAACAGACTCCATGGC
TTCCACTACAACACCCTCAATATCATTGCAAAGCAACAGCTCGAGAACAA
GCTTTCTATCGTCTCCAGGGCCAAAATGCCCAAAACCATTTCAAATAACT
GGCCTTAAACTTCCATTTCTGTCGCATTCAATAAAATTTACACACGTAAA
ATCTTCTGTTACAGACAAGTATAACGAAGTTGTGGTTGATGAAGAAATGG
ACAGGATTCGGAGGCTCCAAAACGGGTCCGATGTTCGCGGCGTTGCCTTG
GAAGGCGAAAAAGGTCGAACAGTTGACCTTACACCGTCAGCTGTGGAAGC
CATTGCGGAGAGTTTTGGAGATGGGTAATCAGAACTTGGAAATGAACGCG
GACGTCCTGTTGAGGATG
back to top