CX295114

Overview
NameCX295114
Unique NameCX295114
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length711
Libraries
Library NameType
DroRLeaf1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05068G03SK DroRLeaf1 Citrus clementina cDNA clone C05068G03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295114 ID=CX295114; Name=CX295114; organism=Citrus clementina; type=EST; length=711bp
GATTCTAAATTCAATCCAAGTCAGTTGCATAATACACAAGTGAGAGAACT
CAAGAAGAAGAGGAAGAAGAAACAGAGCAAATATCAATCATGCTTCAAAT
GCAGTGCTTAAACCTCGCTCCAAAATTCAATCCTTTGCAAAGTCCTGGTT
GCTCTAGAAAATTTGCATCACCAATAGTGACACAGAGACACAAGTCCTCA
ATCAAATGCTCCTCTCAAAGCTCATTTTCTTTCCCAAATCAAAACAAAAT
TTCCCACAATAATAATAAACCACCGTGCAAACCCCTAGTTCCTTTGGCGC
TACAAGATGGTCATGCATTACAACAATCTGAGGATGATAATAAACCAGCT
GCAGCTCCAAGCTTTCTTGAAGTTGTCAAGAGGAAGTTGAATGCAATCAG
CCATGTAACTCGCTATTATGCCCAAATTAACATTATTGTATCGGTAACAT
CGGTTTGCTTTCTTCCCGTACAAAGCCTCTCTCAGGTTACTCCCGCATTT
CTTTTGGGAGTATTGAAGGCTGTAGTGGCACAGATATTTATGAACATTTC
TCTGTGCTCCCTAAACCAGATTTGTGATGTTGAAATAGACAAGATTAACA
AGCCGTATCTGCCACTTGCTTCTGGGGAGTTGTCAATGGGAACTGGAATT
GCAATTTGTGCAGGATCTGCACTCCTGAGTCTGGCTTTGGCATTTCTGTC
TGGATCTCCCG
back to top