CX295173

Overview
NameCX295173
Unique NameCX295173
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length631
Libraries
Library NameType
PhIFruit1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10265 contig Ccv1_Contig10265:77..707. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05069D02SK PhIFruit1 Citrus clementina cDNA clone C05069D02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295173 ID=CX295173|Name=CX295173|organism=Citrus clementina|type=EST|length=631bp
GATTCGGCCGAGGCCTCGTGCCGAATTCGGCACGAGGGAACTATTACCAT
CAAAATCTGGCTTCCTCATCTTCCCCCAGTTCTATTACTGGCAATAGCAA
TGGCAATAGTTTCATTCTCCCAATCAACTTGGCTAGCTCCATTCATAGAT
TTTTGTGGAAGAAGGGCAGGTCATTTTCTTCTGGAGATGGGTTCCTTACT
TCTTCTGATTTCGAGGTCTCTAAGCTGCAGGACAAAACAAGTGGAGAGAA
ATGTCTTTACAAAAACCAGCTTCAGCAAGATGTTAAACAGTTGCAAAAAC
AGTTGCAAGAAGAGATTGACCTGCGCTTGGCTCTAGCGAGTGCTGTTGAG
CATTCTGATTCAACCTCAAATTCTACCTGCCAGCTTCCAGATAAGGCCCA
GGAGCTTCTGGATAGTATAGCTGTCCTGGAGATCACTGTATCTAAGCTTG
AACAAGATATGGAAGCCTTGCAATACCAGCTTAGTCAGGAGAGGAATGAG
CGTCGTCTTGCTGAGTATCGCTTAAGGCATTTATCTAGTCCTGCATCGTC
ACTCTCTAATTGCTCTCCTGCTCACTTGAGAGAACTGATCACAAGACCTT
ATTGTGGATTGAATGATATGAACGTAATGGC
back to top