CX295730

Overview
NameCX295730
Unique NameCX295730
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length722
Libraries
Library NameType
DroRLeaf1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05075C08SK DroRLeaf1 Citrus clementina cDNA clone C05075C08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295730 ID=CX295730|Name=CX295730|organism=Citrus clementina|type=EST|length=722bp
GAGGGTCATGGCATCATCTCCTGCTCCTTCCGTTTCCATCTGCTGTTGCT
GAGAGAGCAGGAAAAAATGTCGAAGCTGTTGTTCCTTCACACTCCTCACT
TCACACCTAAGAAACTCCACACCAAAACTTTCTCAGCAATCGTAACTCAA
AGCCTCACTCCTCTCCACTGCAAATGCCGACTCCTTTCTTTTTCCCTCAA
CACCACCACGACGCGCTCAAATTCTCACTTGCTCTCTCAAATTCATTACC
ACCGCAGAAGCTTCTCCGTTCGTTCTTTCGACGATTCTTCATCCGAGACG
AAGATTCAAGAACCGCAACAACAGGCGGTGGTGAATGAAGATTACGAAAG
CCGAGGGAAATCGAAGGACGTGGACGAGTATCCGAGCGGAGAATTTGAAT
ATGAGAAATTTAGCGCGTGGAAGATATTTACGGTGAAGCTTCGGATGCTT
GTTGCTTTTCCCTGGGAACGCGTTCGCAAGGGCAGCGTTCTCACAATGAA
ATTGCGTGGCCAGATAGCTGATCAGCTAAAGAGCCGTTTCTCCTCGGGAC
TATCACTACCTCAAATTTGTGAAAATTTCGTAAAAGCAGCATATGATCCT
CGTATTGTTGGTATTTATCTCCACATTGAACCCTTAAGCTGTGGATGGGG
AAAAGTTGAAGAAATTCGGAGGCATGTTGTAGACTTCAAGAATCGGGTAA
TTTATTATTGGCTATGTTCTGT
back to top