CX295753

Overview
NameCX295753
Unique NameCX295753
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length703
Libraries
Library NameType
DroRLeaf1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig7631 contig Ccv1_Contig7631:413..1115. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC05075E08SK DroRLeaf1 Citrus clementina cDNA clone C05075E08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295753 ID=CX295753|Name=CX295753|organism=Citrus clementina|type=EST|length=703bp
GAGGGCTATCTGATTTCCAGTTGAACTAAGATTTTCTAATGTCTGGTTTG
GAAATCTTATTGTAAAATATTTTCTTGTAATTTTGATGCCAAATGTCTCC
CCCATGTTTTGAACTTTGATGGTGAAAATGAGGGTTTATATAAGCCAGCT
TTTGTGCTTATGAAAATGTCATCTAGTTTGAATTCTTGTAAATTGTTTAG
ATTGACAAATTCAGCTTTTAAACAGCTATATGTATTAAAACTGTATTGCT
ACTCAAAGAGTCAGAATCTCTCTTCAATCTTCGGTGACATTCCATTCAGG
GTCAAGTGTTAAGTGAGTTAATAAGGTGATTGGAAAGAAAGACACGCAGC
ACATAACCCGGGGTTCAGAGGCATGATGAAATTGGTGACTGGTGAGTTGG
GGACTGGGCTCGGCCCAAGGTCTAATAAGAAATGAAGTGACTGCTAAAAT
TAAACTGTGTTCATGTTTATGCGTCCGTGCTGGGTGATGCTGCTTTGAAT
GGTTGTTCCATGGGAGGGTAGTTCAATTTCCACACTAGGTTAGAATGATT
GTTTACAAGATCTCAATTCTCAAACAAGCGTGTGCACTTTTGAGACTCGG
AAGAATCTCTGAGGTTGGCTTTTGTCTCGGGCGGTGTCCGGAAGAATAGA
GAGTTGACAATGGGACCTGGTGGACCAGGAGGACCAGGAGGACCAGGAGG
CCC
back to top