CX296284

Overview
NameCX296284
Unique NameCX296284
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length137
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15452 contig Ccv1_Contig15452:307..443. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of CX296284 vs. ExPASy Swiss-Prot
Match: CATA_SOLAP (Catalase OS=Soldanella alpina PE=2 SV=1)

HSP 1 Score: 71.2478 bits (173), Expect = 1.766e-12
Identity = 33/35 (94.29%), Postives = 33/35 (94.29%), Query Frame = 1
Query:   31 HLTCADLFRAPGVQTPVIVRFSTVIHERGSPETLR 135
            HLTCAD  RAPGVQTPVIVRFSTVIHERGSPETLR
Sbjct:   83 HLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLR 117          
BLAST of CX296284 vs. ExPASy Swiss-Prot
Match: CATA_PHAAU (Catalase OS=Phaseolus aureus PE=2 SV=1)

HSP 1 Score: 71.2478 bits (173), Expect = 1.766e-12
Identity = 33/35 (94.29%), Postives = 33/35 (94.29%), Query Frame = 1
Query:   31 HLTCADLFRAPGVQTPVIVRFSTVIHERGSPETLR 135
            HLTCAD  RAPGVQTPVIVRFSTVIHERGSPETLR
Sbjct:   83 HLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLR 117          
BLAST of CX296284 vs. ExPASy Swiss-Prot
Match: CATA_PEA (Catalase OS=Pisum sativum PE=2 SV=1)

HSP 1 Score: 71.2478 bits (173), Expect = 1.766e-12
Identity = 33/35 (94.29%), Postives = 33/35 (94.29%), Query Frame = 1
Query:   31 HLTCADLFRAPGVQTPVIVRFSTVIHERGSPETLR 135
            HLTCAD  RAPGVQTPVIVRFSTVIHERGSPETLR
Sbjct:   83 HLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLR 117          
BLAST of CX296284 vs. ExPASy Swiss-Prot
Match: CATA4_SOYBN (Catalase-4 OS=Glycine max GN=CAT4 PE=2 SV=1)

HSP 1 Score: 71.2478 bits (173), Expect = 1.766e-12
Identity = 33/35 (94.29%), Postives = 33/35 (94.29%), Query Frame = 1
Query:   31 HLTCADLFRAPGVQTPVIVRFSTVIHERGSPETLR 135
            HLTCAD  RAPGVQTPVIVRFSTVIHERGSPETLR
Sbjct:   83 HLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLR 117          
BLAST of CX296284 vs. ExPASy Swiss-Prot
Match: CATA3_NICPL (Catalase isozyme 3 OS=Nicotiana plumbaginifolia GN=CAT3 PE=2 SV=1)

HSP 1 Score: 71.2478 bits (173), Expect = 1.766e-12
Identity = 33/35 (94.29%), Postives = 33/35 (94.29%), Query Frame = 1
Query:   31 HLTCADLFRAPGVQTPVIVRFSTVIHERGSPETLR 135
            HLTCAD  RAPGVQTPVIVRFSTVIHERGSPETLR
Sbjct:   83 HLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLR 117          
BLAST of CX296284 vs. ExPASy Swiss-Prot
Match: CATA2_SOLLC (Catalase isozyme 2 OS=Solanum lycopersicum GN=CAT2 PE=2 SV=1)

HSP 1 Score: 71.2478 bits (173), Expect = 1.766e-12
Identity = 33/35 (94.29%), Postives = 33/35 (94.29%), Query Frame = 1
Query:   31 HLTCADLFRAPGVQTPVIVRFSTVIHERGSPETLR 135
            HLTCAD  RAPGVQTPVIVRFSTVIHERGSPETLR
Sbjct:   83 HLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLR 117          
BLAST of CX296284 vs. ExPASy Swiss-Prot
Match: CATA2_MAIZE (Catalase isozyme 2 OS=Zea mays GN=CAT2 PE=2 SV=3)

HSP 1 Score: 71.2478 bits (173), Expect = 1.766e-12
Identity = 33/35 (94.29%), Postives = 33/35 (94.29%), Query Frame = 1
Query:   31 HLTCADLFRAPGVQTPVIVRFSTVIHERGSPETLR 135
            HLTCAD  RAPGVQTPVIVRFSTVIHERGSPETLR
Sbjct:   82 HLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLR 116          
BLAST of CX296284 vs. ExPASy Swiss-Prot
Match: CATA1_WHEAT (Catalase-1 OS=Triticum aestivum GN=CAT1 PE=2 SV=1)

HSP 1 Score: 71.2478 bits (173), Expect = 1.766e-12
Identity = 33/35 (94.29%), Postives = 33/35 (94.29%), Query Frame = 1
Query:   31 HLTCADLFRAPGVQTPVIVRFSTVIHERGSPETLR 135
            HLTCAD  RAPGVQTPVIVRFSTVIHERGSPETLR
Sbjct:   83 HLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLR 117          
BLAST of CX296284 vs. ExPASy Swiss-Prot
Match: CATA1_RICCO (Catalase isozyme 1 OS=Ricinus communis GN=CAT1 PE=2 SV=2)

HSP 1 Score: 71.2478 bits (173), Expect = 1.766e-12
Identity = 33/35 (94.29%), Postives = 33/35 (94.29%), Query Frame = 1
Query:   31 HLTCADLFRAPGVQTPVIVRFSTVIHERGSPETLR 135
            HLTCAD  RAPGVQTPVIVRFSTVIHERGSPETLR
Sbjct:   83 HLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLR 117          
BLAST of CX296284 vs. ExPASy Swiss-Prot
Match: CATA1_NICPL (Catalase isozyme 1 (Fragment) OS=Nicotiana plumbaginifolia GN=CAT1 PE=2 SV=1)

HSP 1 Score: 71.2478 bits (173), Expect = 1.766e-12
Identity = 33/35 (94.29%), Postives = 33/35 (94.29%), Query Frame = 1
Query:   31 HLTCADLFRAPGVQTPVIVRFSTVIHERGSPETLR 135
            HLTCAD  RAPGVQTPVIVRFSTVIHERGSPETLR
Sbjct:   76 HLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLR 110          
The following BLAST results are available for this feature:
BLAST of CX296284 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 31
Match NameE-valueIdentityDescription
CATA_SOLAP1.766e-1294.29Catalase OS=Soldanella alpina PE=2 SV=1[more]
CATA_PHAAU1.766e-1294.29Catalase OS=Phaseolus aureus PE=2 SV=1[more]
CATA_PEA1.766e-1294.29Catalase OS=Pisum sativum PE=2 SV=1[more]
CATA4_SOYBN1.766e-1294.29Catalase-4 OS=Glycine max GN=CAT4 PE=2 SV=1[more]
CATA3_NICPL1.766e-1294.29Catalase isozyme 3 OS=Nicotiana plumbaginifolia GN... [more]
CATA2_SOLLC1.766e-1294.29Catalase isozyme 2 OS=Solanum lycopersicum GN=CAT2... [more]
CATA2_MAIZE1.766e-1294.29Catalase isozyme 2 OS=Zea mays GN=CAT2 PE=2 SV=3[more]
CATA1_WHEAT1.766e-1294.29Catalase-1 OS=Triticum aestivum GN=CAT1 PE=2 SV=1[more]
CATA1_RICCO1.766e-1294.29Catalase isozyme 1 OS=Ricinus communis GN=CAT1 PE=... [more]
CATA1_NICPL1.766e-1294.29Catalase isozyme 1 (Fragment) OS=Nicotiana plumbag... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionC05138D01SK FerrChloL1 Citrus clementina cDNA clone C05138D01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296284 ID=CX296284|Name=CX296284|organism=Citrus clementina|type=EST|length=137bp
ACGAGGCCTCGTCCCGAATTCGGCACGAGGCACCTTACTTGTGCTGATCT
TTTTCGAGCTCCAGGGGTTCAGACACCTGTCATTGTTCGCTTCTCCACTG
TTATCCATGAGCGGGGCAGCCCTGAGACACTCAGGGA
back to top