CX296531

Overview
NameCX296531
Unique NameCX296531
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length679
Libraries
Library NameType
FerrChloL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX296531_ssr181 microsatellite CX296531_ssr181:181..198.
CX296531_ssr280 microsatellite CX296531_ssr280:280..291.
CX296531_ssr312 microsatellite CX296531_ssr312:312..323.
Ccv1_Contig15156 contig Ccv1_Contig15156:75..753. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionC05142F12SK FerrChloL1 Citrus clementina cDNA clone C05142F12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296531 ID=CX296531|Name=CX296531|organism=Citrus clementina|type=EST|length=679bp
GTTTTTTTTTTTTTTTTTTTTTTATCATATAATTGATAATGGAAATTCAC
ATTGACAAAAGGCAAATTACACACTGACTGGGCAGAATAAAAAACAGTCT
CTCTCAAAAGCAATAATTTAAACACTAACACCACCTTAAGGAGACACCCC
AAAAATAAAGCAGCAAGCTCTTACTGTGACCACACACACACACACACACC
AAACTTTTATTATAGAATAAATCTAAGATGATGGATGATGGATGCGTCAC
ATAAAAGTTAATTAATTTAATCGCTGTCACTGCTGCTGCTGCTCTCGTGT
CCGTCCTCGTGCTTCTTCTTCTTCTCCTTCTTTTTCTTCTTCTCTTCACC
GGGGGCGGCGCCCTCGCCGCCGCCGACACCGGGGATCTTCTGCTTGATCT
TGTCCACCAAGCCCTCCTTGTGTTCGCCCTCCTTGTGTTCCCCGCCGTGA
TGCTGCTGCTGATGGTGAACATCAGTAGTGCCGACACCGGGGATCTGCTG
CTTGATCTTGTCCACCAAGCCCTCCTTGTGTTCGCCGCCGTGATACTGCT
GCTGATGGTGGACATCAGTAGTGTGGTGGTCCCCACTATGGTGCTCTCCC
TTGTGCTTGTCCTCCTCCTTTTGCCCTCCTCCCATGTGAAGGGCTTCTCC
GATCTTGTGAATAACTCCTGACATTTTCC
back to top