CX296739

Overview
NameCX296739
Unique NameCX296739
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length335
Libraries
Library NameType
FerrChloL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig26 contig Ccv1_Contig26:1931..2265. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05802C05SK FerrChloL1 Citrus clementina cDNA clone C05802C05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296739 ID=CX296739|Name=CX296739|organism=Citrus clementina|type=EST|length=335bp
ACTCAGGATATGGATACTAAGCTAACTAACAAGGTCACGGGAGGCAAGCA
AATAAGGTTCTGACTTCGTTATAGCAACTATCTTTCAGTTTGACAGCGTT
GGGTTCTCTTCTTCTTGTAAATTCAATTACTCGACTTAGTAGAGTTTATG
GATTCTGGTGAGGATAGCTTGCCAGAGTACGGCTCGTATTAATTTGCAAT
TAGATGTACAATTGCAATGATTTTGAACTTTTTGAGTGAAAGAAATTTTA
TTTTGCTCATCTCCTTCACAGTCTGATACTAATTCTGCGGGTACTCACAT
TTGTAACCATTCAAGACCAAGAGTTATAACATTTA
back to top