CX296745

Overview
NameCX296745
Unique NameCX296745
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length282
Libraries
Library NameType
FerrChloL1cdna_library
Properties
Property NameValue
Genbank descriptionC05802C11SK FerrChloL1 Citrus clementina cDNA clone C05802C11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296745 ID=CX296745|Name=CX296745|organism=Citrus clementina|type=EST|length=282bp
ACCCAAAAAAAATAAAAATTGTAACTACGATCGGCCACTAAATATCGTGG
GGATGGAGAAATTTGGTGTAATTTTTCTTCGATTTTTGTTGAGTTCCAAA
TTAATGAATTCAACAGCTAAAAAAAAAAAACACGGCAATGCTGCTTTTGT
GTTGAAATAGAAAATAAAAAATAAAAGCAAATGTTTACATAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAACCTCGGGGGGGGGCCCGGA
back to top