CX296882

Overview
NameCX296882
Unique NameCX296882
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length707
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CX296882_ssr69 microsatellite CX296882_ssr69:69..80. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05803H03SK FerrChloL1 Citrus clementina cDNA clone C05803H03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296882 ID=CX296882|Name=CX296882|organism=Citrus clementina|type=EST|length=707bp
CAGTGGCCGCTACAACTGCGTCGATCTGTACCTGATGGGATGCCATCAAG
TACTAATGGTGCATCCTTGCAGCAGCAGCAGGAGATAAGTTTGATTCAAG
AGAGAGCACTACCGTCCTCACCTAGTCCATTGTACAGCCCTCACTCAAAA
GCTTCTGGTTTTATGAAAGGTGGTCTAGGACAGCCTGTTGGAAGAAAGCA
GCTTATTGGTGGACATACGATGGTTGACAATTCTAGGGGATTGCTTCAGT
GGGTACAGAGCATCAGCTTTGTAGCAATTTCAATTGATCATTCTCTACAT
CTAGTCCATCAAGCAGATTCACCATCTTCTGGAGGAACCCAGGGTGGCAA
TGGTGTTGGTCCGTCAGGCTATTTGGAAGGATTCACCCCTGTAAAGTCTC
TTGGTGCTACACCTGCATCTTATATTTTGATCCCGTCACCAAGCATGCGC
TTCCTTCCTCCAGCACCTCTTCAGCTCCCTACTTGCCTTACTGCTGGATC
TCCACCCCTTGCTCATCTCCTTCATAGCAAGGGCTCTGCAATCCCCCTCT
CCACTGGATTTGTGGTTTCAAAATCTGTTCCATCTATGAGAAAAGACCAC
AAAAACAAGTTGAAAGATGAATGGCCTTCTGTACTTTCTGTAAATTTAAT
TGATTATTATGGAGGTAATAATATTAGCCAAGATAAAGTCACTAGAGTAA
TTATCAA
back to top