CX296884

Overview
NameCX296884
Unique NameCX296884
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length480
Libraries
Library NameType
FerrChloL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig723 contig Ccv1_Contig723:1..485. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC05803H05SK FerrChloL1 Citrus clementina cDNA clone C05803H05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296884 ID=CX296884|Name=CX296884|organism=Citrus clementina|type=EST|length=480bp
GAGATTTTGCTCCTCGAATGAGAATGAAATGAACTCTCTCCACACCAACA
CCAACACCAACACCAGCACCCCTCTCTCTTTATCTCTTCATTTTCGCACA
ACCATTTCTCTCCCTCTTAACCCACTCTCACTTATTTCTTCTGAATCGAC
TCCGCGAAGCTTTAATCTTCTTCAAAGAGCTCAGAAGTACAGATCTGTGA
GCCCCTTCGAGTTGTAACGACAACAAAGCATAACTGTGTCTTAAAAGAAG
CAAAGATCTGTGAGGCTTCAATCGCAGGAGCAAAAGCAAAAGAAGCAAAA
ATATATATCTTGCCTTCTTTGCCAATCTGCGAGCTTGACACCTGAAGCGC
AGGCAGAGAGGCTGCAGGATTTCAGGCTTCGCTTTTGAAGGCACACTGCA
AAAAGCTTAAACAAAGAGAGAGAAAGAGCCGGGGGCTAAAGCTAAGCAAA
ACTAAACAAAGCTATATATGATAGCTAGCT
back to top