CX296889

Overview
NameCX296889
Unique NameCX296889
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length672
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10391 contig Ccv1_Contig10391:129..800. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05803H10SK FerrChloL1 Citrus clementina cDNA clone C05803H10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296889 ID=CX296889|Name=CX296889|organism=Citrus clementina|type=EST|length=672bp
GTAGTTCATTTCAGGAAATCAAAAAACACGACTCAGTCAAAAGTTGATCT
CTCTTCCTTCTTATTTCTGTCCAATATCCTCTACTCTTTCGCCTCAGCTT
CAACTCTTGTTCACTACGAAAGCACTTTTCTTCTTTTCTTAATCTTCTTC
CTTCAAGTAATCAATTCGCATGATCTTGATTACTAGAGCACTTGTGTAAC
CGAATAAAACAAAATTCAAGATTTAGAGTGGTTTTGGTCACATCCTAGCT
CACATTTTGGTTCCTTTGCTCGTATGAATTGGACTTGCTAGTGATCTCTC
TGCTCAGACTCGTACGGATTCCGGTACTTAGTGTTTCGTCAATTGGTTGC
TAGGGAATTGTTCAGATATGAAAAGGTCGACGATGGATAGGGATCAAAAT
ATTCTTATTACTGAGCTAGCACAAGGGAAAGAGCTAGCTAAGCGGCTTAG
GAATCATCTGAATCCATCTTCCTCTCCAGAAACTCGCGAATTCTTAGTAC
AAGAGATTCTTTCTTCTTATGAGAAAGCACTTTCAATGCTAAATTATAGT
CATTCTCTCCAGTCCAATAAGCTCGACATCACCATGGTTGAATCACCACG
TTCTTTTCCCAACACTGCTACTAGCCCAAGAAGCGATGCTTCTGATCAAG
ACTATTGTAAAGATGTCGTATC
back to top