CX296891

Overview
NameCX296891
Unique NameCX296891
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length225
Libraries
Library NameType
FerrChloL1cdna_library
Properties
Property NameValue
Genbank descriptionC05803H12SK FerrChloL1 Citrus clementina cDNA clone C05803H12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296891 ID=CX296891|Name=CX296891|organism=Citrus clementina|type=EST|length=225bp
ATTCGGCCGAGGCGCCGCTGTCTTTTCCCTTCACTTGAGTTGTATTTTCT
CATAGAAACCTTTCTCTCTGCTCTTCTTCTATTTGTTATTTTCTCTGCAA
GCGATATGGCGGAAGAAGCGGCACAGCAACCGTTAGCTTTTGTGGCGGAA
ACCGTACTGAAGAAAAGAAAAAGCACCGAGGCTTTGGCGCTGACGAGGAA
AGCCCAGTTGGAGGGGGGGCCCGGT
back to top