CX298540

Overview
NameCX298540
Unique NameCX298540
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length722
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of CX298540 vs. ExPASy Swiss-Prot
Match: RAD50_ARATH (DNA repair protein RAD50 OS=Arabidopsis thaliana GN=RAD50 PE=1 SV=2)

HSP 1 Score: 227.639 bits (579), Expect = 5.106e-59
Identity = 119/221 (53.85%), Postives = 156/221 (70.59%), Query Frame = 3
Query:   48 RHEDIEAQKQAKMEIKAGILKHIKEKENERDSFELQISNLNLSHIDERENKMRIEVERKTNQLAEREFEINIRQKQSELFAMDQKIKALNREKDVLAGDSEDRVXXXXXXXXXXXXXXXXXXXXXXXXXXXRDVLKGRLPLDRDLKKEITQALRALLTEFDDLSSKSREADKEVNMLQMKIQEVTDNLSKHRKDVDSKKRFIESKLESLKSAIFSIDTYQK 710
            R + IEAQK+AK EIK GI K I+EKE ERDSFE +IS +++   DERE ++++E+ERKT Q +ER FE  I QKQ E+++++ KIK LNRE+DV+AGD+EDRV                           R VLKGRLP ++D+K+EI QALR++  E+DDLS KSREA+KEVNMLQMKIQEV ++L KH KD +S+KR+IESKL++LK    +ID Y K
Sbjct:  436 RWKSIEAQKRAKDEIKMGISKRIEEKEIERDSFEFEISTVDVKQTDEREKQVQVELERKTKQNSERGFESKIEQKQHEIYSLEHKIKTLNRERDVMAGDAEDRVKLSLKKTEQENLKKKHKKIIDECKDRIRGVLKGRLPPEKDMKREIVQALRSIEREYDDLSLKSREAEKEVNMLQMKIQEVNNSLFKHNKDTESRKRYIESKLQALKQESVTIDAYPK 656          
The following BLAST results are available for this feature:
BLAST of CX298540 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
RAD50_ARATH5.106e-5953.85DNA repair protein RAD50 OS=Arabidopsis thaliana G... [more]
back to top
Properties
Property NameValue
Genbank descriptionC05802A05SK FerrChloL1 Citrus clementina cDNA clone C05802A05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX298540 ID=CX298540|Name=CX298540|organism=Citrus clementina|type=EST|length=722bp
CCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGCCGAATTCGG
CACGAGGATATTGAGGCTCAAAAACAAGCTAAAATGGAAATTAAGGCAGG
CATTTTGAAACACATCAAGGAGAAGGAAAATGAACGTGACTCATTTGAAC
TTCAAATCTCTAATCTCAATCTTTCTCACATTGATGAAAGAGAGAATAAG
ATGCGAATAGAGGTTGAGCGAAAGACTAATCAGCTTGCTGAAAGAGAGTT
TGAAATAAACATACGCCAAAAACAGAGTGAGCTGTTTGCCATGGATCAAA
AAATTAAAGCACTTAATCGAGAGAAAGACGTACTGGCTGGTGATTCTGAA
GACAGAGTGAAACTGGCTTTGAAGAAGGCGGAATTGGAGAATCACAAGAA
GAAACACAAAAAGATAATTGATGAATACAAGGATAAAATCAGAGATGTGC
TTAAAGGGAGGCTTCCTCTTGACAGGGATTTGAAAAAAGAAATTACTCAA
GCCCTAAGGGCTCTTCTGACAGAGTTTGATGACTTGAGCTCAAAATCTCG
TGAAGCTGATAAGGAGGTAAATATGTTGCAGATGAAAATACAAGAAGTGA
CTGATAACCTGTCCAAACATCGCAAGGATGTGGACTCTAAGAAGAGATTT
ATTGAATCCAAACTTGAGTCCTTGAAATCAGCAATTTTCAGCATTGATAC
TTATCAAAAGTCTTGGACTCAG
back to top