CX299924

Overview
NameCX299924
Unique NameCX299924
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length680
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CX299924_ssr283 microsatellite CX299924_ssr283:283..294. BLAST: Citrus ESTs to Prunus persica proteins V1
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07004A11SK SaltLeaf1 Citrus clementina cDNA clone C07004A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX299924 ID=CX299924|Name=CX299924|organism=Citrus clementina|type=EST|length=680bp
GCGCTGACTTGGGCATTCTGGGATTTCCATCCAAAGATTTGCATTACCGG
TTTCTTTCTCAGTTTACCCCAGTGTTTTATATCCGCATCAGAGAGTACTC
AAAGACTGTACCAGTGGCACCTTTTACCATAAATTACAGTGGAGCATTAT
TTCGCCAGTATCCTGGGCCTTGGCAGGTGATGCTTAAACAAGCAGATAGT
TCTTATGCTTGCATAGCAGAGAGTGAAACACGCTTTACACTGAGTGAAAC
CAAAGAAGAGCTGCTGAGAGTCCTAGGACTACAAGAAGAAGAAGGAAGTT
CTTTACAGTTTCTCCGAAGAGGCTATAAGAATGCCACTTGGTGGGAAGAA
GATGTCGATCTAGAATTATCTTCTGCATGGCGTAGTTAAGTGATTGCAGG
AATACTAATCAAGTCTTTGTAAAAGGACCAACACCACCACATTCAAGTAT
TTTCTCAAGCGCGTGTTGCGTTTGAAGAATGCTTTTACTTTACTCTTAGT
GAAGTCTCGTTCGTGCCTTATGATGGGGTGCAAAACGAATGAATATAGGG
CAAGAAAGAATCTCAGAGTTGGTTAACATATGGATTCTGATAAAGCATTG
TTAAAAAGATCAAATTCGAACTTTATTCATTATTTGAATGTAATATACTG
TTTATTATATTAAAAAAAAAAAAAAAAAAA
back to top