CX299936

Overview
NameCX299936
Unique NameCX299936
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length649
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14796 contig Ccv1_Contig14796:694..1342. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07004B12SK SaltLeaf1 Citrus clementina cDNA clone C07004B12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX299936 ID=CX299936|Name=CX299936|organism=Citrus clementina|type=EST|length=649bp
GTGAGGAATGTCATGGACATGCGATCTGTCTATGGAGGATTTGCTGCAGC
TATGAAAGATATCAGTGTTTGGGTCATGAATGTAATCTCAATAGATTCCC
CAGATACACTGCCTATAATTTATGAACGAGGTCTTTTCGGTATATATCAT
GATTGGTGTGAATCATTTAGCACCTACCCTCGAACTTATGATCTCCTCCA
TGCAGACCATCTTTTCTCCAAGATTAAAAAGAGGTGTAATCTAGTAGCTG
TGGTTGCTGAGGTTGATCGGATCCTCAGGCCAGAAGGAAAGCTAATTGTA
CGTGATGATGTTGAGACAATTAATGAGTTAGAGAGCATGGTGAAAGGTAT
GCAGTGGGAGGTTCGGATGACTTACTCCAAGGACAAGGAGGGCTTGCTTT
GCGTCGAAAAGTCCATGTGGCGGCCGAAAGAGTTGGAGACCATCAAATAT
GCTATTGCGTAAACATGCTTTCCTTTCATAGTGCTCTAAAATTCTTGAGG
CCGCAACACTCATGAGATATTAGGTATTCTTTGGTCTCAGAAGTTGGCAA
TTGCCCAATTCAAAGCAACTGGTCTACTAAGTCCTGTGTATCACTATGTT
AAGTAGGTTCCCTTGTTTTTAAAATTTTTTAAATTTTCTTATCCTGTGT
back to top