CX299957

Overview
NameCX299957
Unique NameCX299957
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length312
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07004D10SK SaltLeaf1 Citrus clementina cDNA clone C07004D10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX299957 ID=CX299957|Name=CX299957|organism=Citrus clementina|type=EST|length=312bp
CGGGCTGCAGGATTCGGCACGAGGAGCTCAGATGTCCCAGCAGCACCTGC
AAACACTGCTGTAGGAGGAAAAGCTTCTCTTCAGCCAAAACGTACACCTG
TTTCTAACAGGGAGATAGAGGCTATAATGATGGGATTCACTGAAGAAGCT
TGATGTGCAAACCAGAGTTGGAGGTGGAAGCATCACTTATGCAATCTAAT
AGTTTTCTTTGCTGATATTTGTATTTGATGATTTCATGGGGTGATAGATG
AAAGAACCTCCTTAATTCCACCTAGCTTATTGTGGGTTATTGAAAAAAAA
AAAAAAAAAAAA
back to top