CX300198

Overview
NameCX300198
Unique NameCX300198
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length419
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig880 contig Ccv1_Contig880:363..781. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07007D02SK SaltLeaf1 Citrus clementina cDNA clone C07007D02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX300198 ID=CX300198|Name=CX300198|organism=Citrus clementina|type=EST|length=419bp
GCATCTGGTTCTTCTAATGGTTATAAGCCTATAGGTGATGATAAACATGA
TCGTCCTTTTCATGGCGTTAGAACTACAGTTCGATTGAACAAATTGAAAT
ATGATCGTGAAGTGTTGCGCGGAGGTTCTCTTGTTTTGGAGATTAATCTT
CTAGAGGTTTTTTCCGGAGGAGATGTTGTGGATTCTGATCATACTTTTGA
TGGTCAAGTGTTCTGGAACTTGTACTCGAATTGAATATTGTACGGTGAGA
TAAGTTGATGTGTGTATTAATGGTATTATCTAATATAAACATAGGATTGG
ACATATAGTTGTGTCAATGTATTGTGTAATTTAACTACCTCTAGATAATA
TTATCGTTTGTGTAATGATTGTAATTGATGTTTTGTTGGAGGATCCTTTA
GTATGCTTATAAAAAGGAT
back to top