CX300202

Overview
NameCX300202
Unique NameCX300202
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length440
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig5133 contig Ccv1_Contig5133:119..558. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07007D06SK SaltLeaf1 Citrus clementina cDNA clone C07007D06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX300202 ID=CX300202|Name=CX300202|organism=Citrus clementina|type=EST|length=440bp
AGAAGGCATACTGGGGTCGGCCCAGACGGGCCATATCGCAAGATTAGAGT
TTAAAAGACGTCTCGAGAAAGATGCTGAGGCACGAGAAGCTTTTGAGCAA
CATGTTCGTGAAGAGGCTGAGCGTCGCAGAGCTCTTCGCCAATCTCGGGT
TTTACCGGATACTGCCGAAGAGATGATAGAGTACTTCCTTGATACTGAAG
CTCAGGAGCTTGAGTTTGAAATTGCAAGGCTGAGGCCAAGATTGAACCAG
GAATTTTTCTCACATCTCAAATTTGAACTAGGCCAACTGCGCTTTGCTGT
TTCAAAAACTCAGGATATGGAAGACAGATTGATTGAGCTGGAAGCATTAC
AGAAGGCTCTGCTGGAAGGAACAGAAGCCTATGATAACATGCAAGCGGAC
CTTATAACAGCAAGGAAAAGTCTAACCAAAATCTTGACAT
back to top