CX300204

Overview
NameCX300204
Unique NameCX300204
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length422
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
SaltLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC07007D08SK SaltLeaf1 Citrus clementina cDNA clone C07007D08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX300204 ID=CX300204|Name=CX300204|organism=Citrus clementina|type=EST|length=422bp
ACCAATTGAAAAGAAAAAGCAGAAAAAGCAGTGATGGCATCACTTCCCAT
AATAAGCTTTGCACCAGCAACAGTGAGAGTGTATGCAGCAACAGCAGCAA
AGGAAGCTGGTGGTAGCAAAGAAGAGAAGAGTTTGCTTGATTGGATTCTT
GGGGGTATGCAGAAACAAGATCAGTTTTATGAAACTGATCCAATTTTGAA
GAAAGTTGAAGACAAGAGTCCTCCAAGTGGACGTGGCACAACAAATGGCC
GCAAGAACTCCGCGTCTGTGCCTCAGCCTCAGAAGAAGAAGGGTGGGTTT
GGACTTGGGGATCTCTTTGCCAAGAAATGATTTTTTTTTCCACAAAAAAA
AAAGTACTATTTTATATGTCTCTTTCATTTTTTTGATCTCCCATGATCAT
CGAAATGAATGTGCTGTACGTT
back to top