CX305106

Overview
NameCX305106
Unique NameCX305106
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length448
Libraries
Library NameType
Drought1cdna_library
Properties
Property NameValue
Genbank descriptionC18001B06Rv Drought1 Citrus clementina cDNA clone C18001B06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305106 ID=CX305106; Name=CX305106; organism=Citrus clementina; type=EST; length=448bp
TTTTTTTTTTTTTTTTTTTTTTTTTGAGACTTAAAAGATGTATACATAAC
ATGAGTAGAGATTAACAACAGCAAAAGGATCACAGGCGGGGTTATTTTTA
TTCTGTAATAGAGATAAAAGGTTGCTAGCCTGGTCTATTATTTAGAATGA
TACAGCTAAGTTCATTCATTACGCGGTCATTGATATTGCTTCAGCAGCTT
CAAAAAACCTTGATATTGCGTTAGCAGCCTGAAGTAGCCTTGAGCTTTCC
TCTGATGGAAAAAACAGAACATTCAAAGCCGGTTCATGATCACCAACTAG
AAGCAGACGTCGAACGCCATCCTTAGTTGAAACGCCAATTTTGTTGCAGC
GTCTAGGACAAGATAGACAGACACTTGGACAATGGACAATATTGTATACA
CCACCATATGAAAAATTTCCAGCTTTCTCAATCTTAAACCAATTTAGC
back to top