CX305110

Overview
NameCX305110
Unique NameCX305110
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length319
Libraries
Library NameType
Drought1cdna_library
Properties
Property NameValue
Genbank descriptionC18001B11Rv Drought1 Citrus clementina cDNA clone C18001B11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305110 ID=CX305110; Name=CX305110; organism=Citrus clementina; type=EST; length=319bp
TTTTTTTTATTCATTATGCAGACAGGGAAAAAGATAAGGACTCCAAAACA
CAAAATAGAACTTCTTGGATAACAACAATTCCACACCCAAACTGACTCCA
GCAGAATCATTAAACACCACCTGATCATAAAATCTAAAGCACATTGAAAC
AAAAAAGACCACACACTGCAACTAAAGACTTTCGTTATCATAAGACAACA
AATATCAAGTTACAAGAGACATTAAAGACTCCACCGTCAAGCTTAAAGGT
CTCTGTATACCATCTTTTTCAGTCATCATCATACAGAGAGAACGACCTAC
CCAAGGGTCAATATTCACG
back to top