CX305278

Overview
NameCX305278
Unique NameCX305278
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length330
Libraries
Library NameType
Drought1cdna_library
Properties
Property NameValue
Genbank descriptionC18003E11Rv Drought1 Citrus clementina cDNA clone C18003E11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305278 ID=CX305278; Name=CX305278; organism=Citrus clementina; type=EST; length=330bp
TTTTTTTTTTTTTTTTTTTTTTTGGGGGAATATAATTGATAATGGAAATT
CACATTGACAAAAGGCAAATTACACACTGACTGGGCAAAATAAATAAAAA
AAAAACAGAGTCTCTCAAAAGCAATAATAATTTAAACACAACACCACCTT
GAGGAGACACCCCAAAAATAAAGCAGCAAGCTCTTACTGTGACCACACAC
ACACACACACACCCAATTTTTATTATAGAATAAATCTAAGATGATGGATG
ATGATGCTGATGTTGATTCGTCACATAAAAGTTCATTAATTTAATCGCTG
TCACTGCTGCTGCTGCTCTCGTGTCCCCCG
back to top