CX305298

Overview
NameCX305298
Unique NameCX305298
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length214
Libraries
Library NameType
Drought1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC18003H06Rv Drought1 Citrus clementina cDNA clone C18003H06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX305298 ID=CX305298; Name=CX305298; organism=Citrus clementina; type=EST; length=214bp
GCGGGAAGAGAAAGCTGCAAAAGCTCGAGAGAATCTGAAGATGCTGGAAA
GGGCTCTGGAGGGGAAGCCCTTTTTTGGTGGTGACAAGATAGGCTTTCTG
GACATTGCTGTGGGGTGGATTGGAATCTGGGGTCGAATTGTTGAGGAAAT
TGCAGGTGTCAGCCTGATTGATGCAGAGACGATGCCTTTGCTTGCTGCTT
GGTTGAACAATTTT
back to top