CX306090

Overview
NameCX306090
Unique NameCX306090
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length413
Libraries
Library NameType
Drought1cdna_library
Properties
Property NameValue
Genbank descriptionC18013G12Rv Drought1 Citrus clementina cDNA clone C18013G12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX306090 ID=CX306090; Name=CX306090; organism=Citrus clementina; type=EST; length=413bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAACAGCGAAAGCATCAT
AGGCTATTTTATTTATGCTTAACCATAGAGATTAAAGAGTACTAGCCTGG
TCCATTATTTAGAATAATACAGCCTGTTGGCTTATTCATTACAGAGACGG
AAATAACATAGATCTTCCACTATCAGCTGGAAATAACACAACAGGCAAAG
GCAGATTCGGCTGATCATTATCATCAACCACAACTAGACGTTGGACGCCA
TCCATATTAGAAACGCCAACGTCTTTGCAGAGTGTATCGCAAGAACCATT
AACAAGTGTTGAACAATGAACAATTTTGTATAGACAGGGAATGTCTAGTG
CTATTTTCATATCAAATATTGATGCACTAACTTTCTCAAGTTTAAAAAAA
TTTTGACACGTTT
back to top