CX306091

Overview
NameCX306091
Unique NameCX306091
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length356
Libraries
Library NameType
Drought1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC18013H02Rv Drought1 Citrus clementina cDNA clone C18013H02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX306091 ID=CX306091; Name=CX306091; organism=Citrus clementina; type=EST; length=356bp
GTGGGGGGCAAATAATCTTGATCCTTCTGGGAGGGCTGCACTGGGAGTTC
ATCTATCAGCTTATGAAAAGCAGGTAGCTGCTTCAAATGCTGTTAAGGCA
CCACCAAAGGTCATCGATAACATACCACGAATGATGGAAGTTGCTGCTCC
AGGGCTTGCAATCACTAGCTAGTGTCTGTGGAATCCCCCAAGAGTGGGTG
AACTTAAGACAGAAAAATATATCATCTATGGATCTTTTATATGTTCTGCT
GTATTGTAATTTCATTTTTGGCAATGTGTACAAGTTAGAAAACATTGCAC
ATGGTTGTTTATATGTATGTGATCTTCATAAGTAAAAAAAAAAAAAGAAA
AAAAAA
back to top