CX308540

Overview
NameCX308540
Unique NameCX308540
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length325
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21001B03Rv AbsLeaSub1 Citrus clementina cDNA clone C21001B03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308540 ID=CX308540|Name=CX308540|organism=Citrus clementina|type=EST|length=325bp
GCGGGAAGAAATAAAACTTGAGAGGCATGTTAGCCTTTCCAATAATTTAT
CCCAAGAAGATGCGTCCTCATTGATGTGCTTCAATATTGTGGATGGGAAA
ATGGGGTATTAAAAAATGTTCAACATCACCGTCCACTTAATAAATGTTAC
TTCACTCATTTGAGATGCACATTTCAGGATAATATTTAGAATGTTTTAAT
TAGCATAGTTAATTCTATCACTCGTTGCTTTGAATATGTCAGTAAATTTT
GGTATCAACAAGTGTCGGCATTAATACTGTATTCTCTTCGAATGAAAGAA
TTAGTATGTGGCCCTTTGGTTTGTG
back to top