CX309108

Overview
NameCX309108
Unique NameCX309108
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length205
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig980 contig Ccv1_Contig980:1..205. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC21008F07Rv AbsLeaSub1 Citrus clementina cDNA clone C21008F07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX309108 ID=CX309108|Name=CX309108|organism=Citrus clementina|type=EST|length=205bp
ATCTTGTGCAGGTAGAAAAATCTTGAGCATGGAGGCAATGAAGGTTCCTG
TTTTAAAGGGCAAAACGACACCGATTTCTTTTGGTAGACGATTTGGTTAT
GAAATGGCTAATACTATGGGAATTCCCGAGGCTGCAGGTGACCACCGAAT
TTTGCAGCAGTCAAATCCAAGCCCTTCCATCGGCAACTAGACTCAACATT
AATTT
back to top