DY259730

Overview
NameDY259730
Unique NameDY259730
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1047
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig1291 contig Ccv1_Contig1291:1..1047. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of DY259730 vs. ExPASy Swiss-Prot
Match: BUB1B_MOUSE (Mitotic checkpoint serine/threonine-protein kinase BUB1 beta OS=Mus musculus GN=Bub1b PE=1 SV=1)

HSP 1 Score: 71.2478 bits (173), Expect = 1.098e-11
Identity = 71/272 (26.10%), Postives = 120/272 (44.12%), Query Frame = 2
Query:    5 RYLFVWLEYAENCIDAQVIFSFLDANDIGKTHSVYYIAYALHMESKSKMKAANDLFSLGISRNAQPTEKLKDAYKKFLVRSMRKTQVI----DEDSKENHLPVRSFGTVLAREENRRQAMQSSDMQR--KKLKPDGNHR-----APFSVYK-------DTNVDITSCHQPDNSKTECNSWLTLGAQAERNKENNAKPAKWTSCXXXXXXXXXXXXATTS-----DHIEMFIDEECAETDTTRNKIGKSSNLF-----PAKQVEGQKLIRKQS 736
            R+L +W++    C +   ++S+L +  IG + + +YI++A   E++   K A+ +F  GI R A+P ++L+  +++F  R  R+  +     +E++ E   P RS    LA  ++R + M  + + R    LK  G  R      P  V+        D N D TS  +P+ SK     W  +     R KEN  +P  W++             + TS          +++E   +T  T  KI  S N       P ++ EG  L R QS
Sbjct:  114 RFLSLWIKLGHLCNEPLDMYSYLQSQGIGVSLAQFYISWAEEYEARENFKKADIIFQEGIERKAEPLDRLQSQHRQFQSRVSRQAFLALGNEEEEALEPSEPQRS---SLAELKSRGKKMARAPISRVGGALKAPGQSRGFLNAVPQPVHGNRRITVFDENADTTS--RPELSKPVAQPW--MAPPVPRAKENELQPGPWSTDRPAGRRPHDNPASVTSIPSVLPSFTPYVEESAQQTVMTPCKIEPSINHVLSTRKPGRE-EGDPLQRVQS 377          
The following BLAST results are available for this feature:
BLAST of DY259730 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
BUB1B_MOUSE1.098e-1126.10Mitotic checkpoint serine/threonine-protein kinase... [more]
back to top
Libraries
Library NameType
Fruit-TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP10YA08FM1 Fruit-TF Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY259730 ID=DY259730|Name=DY259730|organism=Citrus clementina|type=EST|length=1047bp
TCTGCGCTACCTCTTTGTCTGGTTGGAATATGCTGAAAATTGTATTGATG
CACAAGTCATCTTCAGTTTCCTTGATGCAAATGATATTGGGAAGACACAT
TCTGTGTACTACATAGCATATGCTTTGCACATGGAATCCAAGTCCAAGAT
GAAAGCCGCAAATGACTTATTCAGTCTTGGGATATCTAGGAATGCTCAAC
CAACAGAAAAGTTGAAGGATGCCTACAAGAAATTTCTTGTACGCTCAATG
AGAAAAACACAAGTCATCGACGAGGACTCAAAGGAAAATCACTTACCTGT
CAGAAGCTTTGGAACTGTCCTGGCCAGGGAGGAAAATCGAAGGCAGGCCA
TGCAGAGTTCTGATATGCAGAGGAAAAAGTTGAAGCCAGATGGGAATCAC
AGGGCTCCATTTAGTGTTTACAAAGATACAAATGTTGATATCACGTCGTG
TCATCAACCTGATAACTCTAAGACAGAATGTAATTCCTGGCTCACTCTTG
GAGCTCAAGCTGAGAGAAATAAAGAAAATAATGCAAAGCCTGCTAAGTGG
ACATCGTGCCAGATTCCCCAAAGGCCAGGCCCTGGAATTGGAGGGGCAAC
CACAAGTGACCATATTGAAATGTTTATTGACGAAGAATGTGCCGAAACCG
ATACAACAAGAAACAAAATTGGCAAGTCCTCCAATTTGTTCCCGGCCAAG
CAGGTGGAGGGCCAGAAATTAATAAGGAAACAAAGTTGTTGAGGAAAAAC
CCATTACCCCATTCCCCCCCCAAAAACCTTCCCAAAAGAATAAATTCCCA
CACAAACCCCCTTCTTGGGAAATAACATTGGTTTTAAAAGCCCATTAACC
TACCTGGGGTCCCTTTTTATCTCCAAAACCGGGATTCCTTTTAAATTCCC
TTTTCCTCCAATTTTTCCCCGGGCCGGAAAAAGATTAAAAACCCCTCCCC
CTCCCCCCGCCCCTGGGCCCAGGGGCCCAAAAAAAGTTTCAAACTCTGGA
AAACCTCTACAAATTAAAATTATTAACAAAATTACAATTTTTTTTTT
back to top