DY259742

Overview
NameDY259742
Unique NameDY259742
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length1092
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14779 contig Ccv1_Contig14779:2..1093. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Fruit-TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP10YA22FM1 Fruit-TF Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY259742 ID=DY259742|Name=DY259742|organism=Citrus clementina|type=EST|length=1092bp
GTTATATGAAATTATATACAATTGATGCTTTCTTTTCTTATATACCCCAA
GCACTTGCCACCTCCTGAAATTTCCAATTCATATTTTGTTGATCATTTTA
GCTGTTAGGGTTCCTCATTCACCATTATTTGTTAAAGTGTGAAATGTAAG
ATGCCTCTTTGAATAGAAATGGCAGGCAAACCGTGGAAGCAGTGGTTCAA
AGAGTGGTACAAAGATTCCAAAACAAGTTGCTTTTATGTGGAGAACTCTT
GCTAGATGTCGGAAATTTGAAGAAACAGGCAAAAGCTGCTTTACTGAGCC
TGCACTTCGAGATGTTATTTTCGCAACACCTCCCAGAAGAAATGATGCTG
AATCTACCAAAAGCTTCGGGTTTCTTGCAAATATAAAACCTGAAGTGGCT
AAGTCTCGGTCACTGCCGACAGGTTTGCCATTTATTTCTGTTGTGATTTC
AAGGAATATATTGACAAATTTTAACATGCTTTGAATTTTTTTACAAGCAT
ATATTTTTGGCAATTTTATGTTCTGGTTTGCCAAATTTTGTGGATGCCAA
AGGTTCTGGTATTAAATTAGGTGCCTCCAATTATTTAATATTTAATCAAT
TGATTTTCTGCTTTTGCAGGCAGCTTTCCTGGTAGTACTGAGCAGCATGA
TTTCCATGATGACACTATTGAGAGGGGATCATTTGATGCATATGGAGCTC
ATACCCAGCCCATAGACCAAGACTTTGTCAAAACTGGACCAATTTTTAAC
AGAGGGAGGAAGAAGGAAGTGCTGCTTGATGAATGTGGTGGCATGGCTTC
CTTTAGAAGCTCCTCCCCCTCTTGGTAATGCTGGGCGGGGCCAAAGGAAA
AAAAAAATGAAAAAAAAAGGGAACAAGAAAACTTCCATCCAAAATGCAAA
AATCGGGCCCGGCTTTCATGGGGTAATTTTAAAGGGGGGACCCAAAAAAT
AAAAACCAAACCCAAAAAAAAAAAAAAGCCCCCATTAATCAACTTCCGGG
AAAAGGGTTTTTTTTGAAAAAGTTTTAAGAAAAAAAAAACTCAAAAAGGG
GTTTTTTCTTCCAACCTCCCTGTTTTCCCCAAAAAAAAATTA
back to top