|
|
Marker Overview
| Name | mCrCIR02B11 |
|---|
| Genbank ID | FR692358 |
|---|
| Type | SSR |
|---|
| Species | Citrus reshni |
|---|
| Repeat Motif | (GA)11 |
|---|
| Primer 1 | mCrCIR02B11.Forward Primer: GTATTTGGCGTGATGAA |
|---|
| Primer 2 | mCrCIR02B11.Reverse Primer: CAAAGTAAATAGGGTGTGAG |
|---|
| Publication | [view all] |
|---|
| Contact | Patrick Ollitrault
|
|---|
Publications
| Year | Publication |
|---|
| 2012 | Ollitrault, P, Terol, J, Chen, C, Federici, CT, Lotfy, S, Hippolyte, I, Ollitrault, F, Bérard, A, Chauveau, A, Cuenca, J, Costantino, G, Kacar, Y, Mu, L, Garcia-Lor, A, Froelicher, Y, Aleza, P, Boland, A, Billot, C, Navarro, L, Luro, F, Roose, ML, Gmitter, FG, Talon, M, and Brunel, D. A reference genetic map of C. clementina hort. ex Tan.; citrus evolution inferences from comparative mapping. BMC Genomics. 2012. 13:593. |
|
