CX296576

Overview
NameCX296576
Unique NameCX296576
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length676
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig694 contig Ccv1_Contig694:1..676. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of CX296576 vs. ExPASy Swiss-Prot
Match: ADCL1_MOUSE (Neutral cholesterol ester hydrolase 1 OS=Mus musculus GN=Nceh1 PE=1 SV=1)

HSP 1 Score: 68.5514 bits (166), Expect = 3.539e-11
Identity = 55/179 (30.73%), Postives = 81/179 (45.25%), Query Frame = 2
Query:   74 PWKAWLSISTLSFAMQIC-FRRNMTVNRFL---------FNLYDRKSSPSTKNGVTSFDVSVDATRDLWFRLYSPTNTTATNLP-VIVYFHGGGFAILAANSKVYDDACRRLAVEVPAVVISVNYRRSPEHRCPSQYEDGIDALK-FIDSSFIDIENFPACADIKQCFLAGDSAGGNLA 574
            PWK  L  +T   A Q+     ++ +N  L         F     +SSP  K   T FD        +  R++  +      L   ++Y HGGG+A+ +A    YD  C  +A E+ AV++S+ YR  P+   P Q  D I A K F+    +D        D  +  ++GDSAGGNLA
Sbjct:   30 PWKLMLLDATFRGAQQVSNLIHSLGLNHHLIALNFIITSFGKQSARSSPKVKVTDTDFD-------GVEVRVFEGSPKPEEPLRRSVIYIHGGGWALASAKISYYDQLCTTMAEELNAVIVSIEYRLVPQVYFPEQIHDVIRATKYFLQPEVLDKYK----VDPGRVGISGDSAGGNLA 197          
The following BLAST results are available for this feature:
BLAST of CX296576 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 11
Match NameE-valueIdentityDescription
ADCL1_MOUSE3.539e-1130.73Neutral cholesterol ester hydrolase 1 OS=Mus muscu... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionC05146C09SK FerrChloL1 Citrus clementina cDNA clone C05146C09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296576 ID=CX296576|Name=CX296576|organism=Citrus clementina|type=EST|length=676bp
GATTCGGCCGAGGCCTCGTGCCGAATTCGGCACGAGGATAATGTCCACGA
ATTCCAAAACTTCACCAAACCTCCCATGGAAGGCATGGCTCTCCATATCG
ACGCTCTCCTTTGCCATGCAAATATGTTTCCGCCGCAACATGACTGTCAA
TCGTTTCCTCTTTAACCTCTATGATCGCAAATCCTCTCCTTCAACCAAAA
ATGGCGTCACGAGCTTCGATGTCTCAGTCGACGCCACCCGGGATCTCTGG
TTCCGCCTCTACTCGCCCACCAACACGACTGCAACAAACTTGCCAGTCAT
CGTCTACTTCCACGGCGGAGGATTTGCAATCCTTGCTGCCAATTCAAAAG
TATACGATGATGCTTGTAGAAGGCTAGCTGTGGAAGTCCCGGCTGTCGTC
ATTTCCGTTAACTATCGTCGTTCGCCGGAGCATCGGTGTCCAAGTCAATA
CGAAGATGGGATTGATGCACTCAAATTCATTGACAGCAGCTTCATAGACA
TTGAAAACTTTCCGGCTTGTGCTGATATCAAACAGTGTTTTCTTGCCGGA
GATAGTGCCGGAGGCAACTTGGCCCATAACGTGGCAGTTCTTGCTGATGG
GTGTAATTTTTCCAGGCTGAGACTTAATGGACTCATAGCGATACAGCCAT
TTTTCGGCGGTGAAGAAAGGACTGAA
back to top